TNF cDNA ORF Clone, Human, C-Myc tag - CD BioSciences

service-banner

TNF cDNA ORF Clone, Human, C-Myc tag

TNF cDNA ORF Clone, Human, C-Myc tag

SPD-15005

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human tumor necrosis factor (TNF superfamily, member 2) with C terminal Myc tag.
Target Information
Species Human
Target Name TNF-α
Gene Abbr. TNF
Gene ID 7124
Full Name tumor necrosis factor
Alias DIF, TNF-alpha, TNFA, TNFSF2, TNLG1F
Introduction TNF-α, the prototypical member of the TNF protein superfamily, is a homotrimeric type-II membrane protein. Membrane-bound TNF-α is cleaved by the metalloprotease TACE/ADAM17 to generate a soluble homotrimer. Both membrane and soluble forms of TNF-α are biologically active. TNF-α is produced by a variety of immune cells including T cells, B cells, NK cells, and macrophages. Cellular response to TNF-α is mediated through interaction with receptors TNF-R1 and TNF-R2 and results in activation of pathways that favor both cell survival and apoptosis depending on the cell type and biological context. Activation of kinase pathways (including JNK, Erk1/2, p38 MAPK, and NF-κB) promotes the survival of cells, while TNF-α-mediated activation of caspase-8 leads to programmed cell death. TNF-α plays a key regulatory role in inflammation and host defense against bacterial infection, notably Mycobacterium tuberculosis.
Product Details
Description Full length Clone DNA of Human tumor necrosis factor (TNF superfamily, member 2) with C terminal Myc tag.
NCBI Ref Seq NM_000594.2
RefSeq ORF Size 702 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Restriction Sites KpnI + XbaI (6kb + 0.75kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.