Online Inquiry
TNF cDNA ORF Clone, Ferret, C-Myc tag
SPD-14995
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Ferret TNF alpha with C terminal Myc tag. |
Target Information | |
---|---|
Species | Ferret |
Target Name | TNF-α |
Gene Abbr. | TNF |
Gene ID | 101687148 |
Full Name | tumor necrosis factor |
Introduction | TNF-α, the prototypical member of the TNF protein superfamily, is a homotrimeric type-II membrane protein. Membrane-bound TNF-α is cleaved by the metalloprotease TACE/ADAM17 to generate a soluble homotrimer. Both membrane and soluble forms of TNF-α are biologically active. TNF-α is produced by a variety of immune cells including T cells, B cells, NK cells, and macrophages. Cellular response to TNF-α is mediated through interaction with receptors TNF-R1 and TNF-R2 and results in activation of pathways that favor both cell survival and apoptosis depending on the cell type and biological context. Activation of kinase pathways (including JNK, Erk1/2, p38 MAPK, and NF-κB) promotes the survival of cells, while TNF-α-mediated activation of caspase-8 leads to programmed cell death. TNF-α plays a key regulatory role in inflammation and host defense against bacterial infection, notably Mycobacterium tuberculosis. |
Product Details | |
---|---|
Description | Full length Clone DNA of Ferret TNF alpha with C terminal Myc tag. |
NCBI Ref Seq | EF368211.1 |
RefSeq ORF Size | 702 bp |
Vector | pCMV3-C-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.