Tmod1 cDNA ORF Clone, Mouse, N-FLAG tag - CD BioSciences

service-banner

Tmod1 cDNA ORF Clone, Mouse, N-FLAG tag

Tmod1 cDNA ORF Clone, Mouse, N-FLAG tag

SPD-14713

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse tropomodulin 1 with N terminal Flag tag.
Target Information
Species Mouse
Target Name TMOD1
Gene Abbr. Tmod1
Gene ID 21916
Full Name tropomodulin 1
Alias E-Tmo, E-Tmod, Tmod
Introduction Tropomodulin-1 (TMOD1) belongs to a conserved family of cytoskeletal proteins (TMOD1-4) that play an important role in modulating actin cytoskeleton dynamics. TMOD proteins function as actin capping proteins, which stabilize actin filaments by inhibiting both elongation and depolymerization. While many proteins have been identified that cap the rapidly growing barbed end of actin filaments, TMODs are the only proteins thus far identified that cap the slowly growing pointed end. A research study in triple-negative breast cancer cells identified TMOD1 as a target of NF-κB signaling, and showed that increased TMOD1 expression was associated with enhanced tumor growth in a mouse xenograft model. Molecular expression of TMOD1 was also identified as part of a unique gene expression signature that could discriminate ALK-negative anaplastic large-cell lymphoma from other malignancy subtypes.
Product Details
Description Full length Clone DNA of Mouse tropomodulin 1 with N terminal Flag tag.
NCBI Ref Seq NM_021883.2
RefSeq ORF Size 1080 bp
Vector pCMV3-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.