Online Inquiry
TMOD1 cDNA ORF Clone, Human, N-Myc tag
SPD-14726
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human tropomodulin 1 with N terminal Myc tag. |
Target Information | |
---|---|
Species | Human |
Target Name | TMOD1 |
Gene Abbr. | TMOD1 |
Gene ID | 7111 |
Full Name | tropomodulin 1 |
Alias | D9S57E, ETMOD, TMOD |
Introduction | Tropomodulin-1 (TMOD1) belongs to a conserved family of cytoskeletal proteins (TMOD1-4) that play an important role in modulating actin cytoskeleton dynamics. TMOD proteins function as actin capping proteins, which stabilize actin filaments by inhibiting both elongation and depolymerization. While many proteins have been identified that cap the rapidly growing barbed end of actin filaments, TMODs are the only proteins thus far identified that cap the slowly growing pointed end. A research study in triple-negative breast cancer cells identified TMOD1 as a target of NF-κB signaling, and showed that increased TMOD1 expression was associated with enhanced tumor growth in a mouse xenograft model. Molecular expression of TMOD1 was also identified as part of a unique gene expression signature that could discriminate ALK-negative anaplastic large-cell lymphoma from other malignancy subtypes. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human tropomodulin 1 with N terminal Myc tag. |
NCBI Ref Seq | BC002660 |
RefSeq ORF Size | 1080 bp |
Vector | pCMV3-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.