TLR4 cDNA ORF Clone, Rhesus, C-HA tag - CD BioSciences

service-banner

TLR4 cDNA ORF Clone, Rhesus, C-HA tag

TLR4 cDNA ORF Clone, Rhesus, C-HA tag

SPD-15016

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus toll-like receptor 4 with C terminal HA tag.
Target Information
Species Rhesus
Target Name Toll-like Receptor
Gene Abbr. TLR4
Gene ID 574360
Full Name toll like receptor 4
Introduction The Toll-like receptor (TLR) family in mammal comprises a family of transmembrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and IL-1 receptor motif in the cytoplasmic domain. Like its counterparts in Drosophila, TLRs signal through adaptor molecules. The TLR family is a phylogenetically conserved mediator of innate immunity that is essential for microbial recognition. Ten human homologs of TLRs (TLR1-10) have been described. Among this family of receptors, TLR2 and TLR4 have been most studied. These studies have suggested that TLR2 and TLR4 may serve as potential main mediators of LPS signaling.
Product Details
Description Full length Clone DNA of Rhesus toll-like receptor 4 with C terminal HA tag.
NCBI Ref Seq NM_001037092.1
RefSeq ORF Size 2481 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 2097G/C not causing the amino acid variation.
Please check the sequence information before order.
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Restriction Sites KpnI + NotI (6kb + 2.52kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.