Online Inquiry
Tlr4 cDNA ORF Clone, Rat, C-FLAG tag
SPD-15023
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rat toll-like receptor 4 with C terminal Flag tag. |
Target Information | |
---|---|
Species | Rat |
Target Name | Toll-like Receptor |
Gene Abbr. | Tlr4 |
Gene ID | 29260 |
Full Name | toll-like receptor 4 |
Introduction | The Toll-like receptor (TLR) family in mammal comprises a family of transmembrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and IL-1 receptor motif in the cytoplasmic domain. Like its counterparts in Drosophila, TLRs signal through adaptor molecules. The TLR family is a phylogenetically conserved mediator of innate immunity that is essential for microbial recognition. Ten human homologs of TLRs (TLR1-10) have been described. Among this family of receptors, TLR2 and TLR4 have been most studied. These studies have suggested that TLR2 and TLR4 may serve as potential main mediators of LPS signaling. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rat toll-like receptor 4 with C terminal Flag tag. |
NCBI Ref Seq | NM_019178.1 |
RefSeq ORF Size | 2508 bp |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.