TLR4 cDNA ORF Clone, Human, C-FLAG tag - CD BioSciences

service-banner

TLR4 cDNA ORF Clone, Human, C-FLAG tag

TLR4 cDNA ORF Clone, Human, C-FLAG tag

SPD-15043

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human toll-like receptor 4, transcript variant 1 with C terminal Flag tag.
Target Information
Species Human
Target Name Toll-like Receptor
Gene Abbr. TLR4
Gene ID 7099
Full Name toll like receptor 4
Alias ARMD10, CD284, TLR-4, TOLL
Introduction The Toll-like receptor (TLR) family in mammal comprises a family of transmembrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and IL-1 receptor motif in the cytoplasmic domain. Like its counterparts in Drosophila, TLRs signal through adaptor molecules. The TLR family is a phylogenetically conserved mediator of innate immunity that is essential for microbial recognition. Ten human homologs of TLRs (TLR1-10) have been described. Among this family of receptors, TLR2 and TLR4 have been most studied. These studies have suggested that TLR2 and TLR4 may serve as potential main mediators of LPS signaling.
Product Details
Description Full length Clone DNA of Human toll-like receptor 4, transcript variant 1 with C terminal Flag tag.
NCBI Ref Seq NM_138554.2
RefSeq ORF Size 2520 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + NotI (6kb + 2.57kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.