Tle1 cDNA ORF Clone, Mouse, N-His tag - CD BioSciences

service-banner

Tle1 cDNA ORF Clone, Mouse, N-His tag

Tle1 cDNA ORF Clone, Mouse, N-His tag

SPD-14695

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse transducin-like enhancer of split 1, homolog of Drosophila E(spl) with N terminal His tag.
Target Information
Species Mouse
Target Name TLE1
Gene Abbr. Tle1
Gene ID 21885
Full Name transducin-like enhancer of split 1
Alias C230057C06Rik, Estm1, Estm14, Grg, Grg-1
Introduction Transducin-like enhancer of split proteins (TLE1, TLE2, TLE3, TLE4, and TLE6) are mammalian homologs of Drosophila Groucho. TLEs contain several WD-repeats implicated in protein-protein interaction. TLEs are transcriptional co-repressors that bind to many transcription factors such as LEF1, Runx1, Oct-1, hepatocyte nuclear factor 3-β as well as histone H3. TLEs are differentially expressed during animal development and may have overlapping as well as distinct functions.
Product Details
Description Full length Clone DNA of Mouse transducin-like enhancer of split 1, homolog of Drosophila E(spl) with N terminal His tag.
NCBI Ref Seq BC057573.1
RefSeq ORF Size 2310 bp
Vector pCMV3-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.