Online Inquiry
Tle1 cDNA ORF Clone, Mouse, C-HA tag
SPD-14692
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse transducin-like enhancer of split 1, homolog of Drosophila E(spl) with C terminal HA tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | TLE1 |
Gene Abbr. | Tle1 |
Gene ID | 21885 |
Full Name | transducin-like enhancer of split 1 |
Alias | C230057C06Rik, Estm1, Estm14, Grg, Grg-1 |
Introduction | Transducin-like enhancer of split proteins (TLE1, TLE2, TLE3, TLE4, and TLE6) are mammalian homologs of Drosophila Groucho. TLEs contain several WD-repeats implicated in protein-protein interaction. TLEs are transcriptional co-repressors that bind to many transcription factors such as LEF1, Runx1, Oct-1, hepatocyte nuclear factor 3-β as well as histone H3. TLEs are differentially expressed during animal development and may have overlapping as well as distinct functions. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse transducin-like enhancer of split 1, homolog of Drosophila E(spl) with C terminal HA tag. |
NCBI Ref Seq | BC057573.1 |
RefSeq ORF Size | 2310 bp |
Vector | pCMV3-C-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.