TLE1 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

TLE1 cDNA ORF Clone, Human, untagged

TLE1 cDNA ORF Clone, Human, untagged

SPD-14708

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila).
Target Information
Species Human
Target Name TLE1
Gene Abbr. TLE1
Gene ID 7088
Full Name TLE family member 1, transcriptional corepressor
Alias ESG, ESG1, GRG1
Introduction Transducin-like enhancer of split proteins (TLE1, TLE2, TLE3, TLE4, and TLE6) are mammalian homologs of Drosophila Groucho. TLEs contain several WD-repeats implicated in protein-protein interaction. TLEs are transcriptional co-repressors that bind to many transcription factors such as LEF1, Runx1, Oct-1, hepatocyte nuclear factor 3-β as well as histone H3. TLEs are differentially expressed during animal development and may have overlapping as well as distinct functions.
Product Details
Description Full length Clone DNA of Human transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila).
NCBI Ref Seq NM_005077.3
RefSeq ORF Size 2313 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the mutation 354 A/G not causing the amino acid variation.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites HindIII + XbaI (6.1kb + 2.31kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.