Tk1 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Tk1 cDNA ORF Clone, Mouse, untagged

Tk1 cDNA ORF Clone, Mouse, untagged

SPD-14666

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse thymidine kinase 1.
Target Information
Species Mouse
Target Name TK1
Gene Abbr. Tk1
Gene ID 21877
Full Name thymidine kinase 1
Alias D530002A18Rik, Tk-1, Tk1a, Tk1b
Product Details
Description Full length Clone DNA of Mouse thymidine kinase 1.
NCBI Ref Seq NM_001271729.1
RefSeq ORF Size 594 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.