Online Inquiry
TIRAP Knockout Cell Line
SPL-03644
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 5bp deletion |
| Target Information | |
|---|---|
| Target Name | TIRAP |
| Gene Abbr. | TIRAP |
| Gene ID | 114609 |
| Full Name | TIR domain containing adaptor protein |
| Alias | BACTS1, Mal, MyD88-2, wyatt |
| Species | Human |
| Genomic Locus | chr11:126292540 |
| Transcript | NM_001039661 |
| WT Expression Level | 5.86 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The innate immune system recognizes microbial pathogens through Toll-like receptors (TLRs), which identify pathogen-associated molecular patterns. Different TLRs recognize different pathogen-associated molecular patterns and all TLRs have a Toll-interleukin 1 receptor (TIR) domain, which is responsible for signal transduction. The protein encoded by this gene is a TIR adaptor protein involved in the TLR4 signaling pathway of the immune system. It activates NF-kappa-B, MAPK1, MAPK3 and JNK, which then results in cytokine secretion and the inflammatory response. Alternative splicing of this gene results in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of TIRAP. |
| Description | 5bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AGGCTGTGAAGCATCGCTGG |
| PCR Primer |
Forward: GAGAATAAGATGTTTCCCAGTGCAG Reverse: AGACGTCATAGTCTTTGCTCCAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.