Online Inquiry
THRB Knockout Cell Line
SPL-03638
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 8bp deletion |
| Target Information | |
|---|---|
| Target Name | THRB |
| Gene Abbr. | THRB |
| Gene ID | 7068 |
| Full Name | thyroid hormone receptor beta |
| Alias | C-ERBA-2, C-ERBA-BETA, ERBA2, GRTH, NR1A2 |
| Species | Human |
| Genomic Locus | chr3:24190081 |
| Transcript | NM_000461 |
| WT Expression Level | 5.07 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a nuclear hormone receptor for triiodothyronine. It is one of the several receptors for thyroid hormone, and has been shown to mediate the biological activities of thyroid hormone. Knockout studies in mice suggest that the different receptors, while having certain extent of redundancy, may mediate different functions of thyroid hormone. Mutations in this gene are known to be a cause of generalized thyroid hormone resistance (GTHR), a syndrome characterized by goiter and high levels of circulating thyroid hormone (T3-T4), with normal or slightly elevated thyroid stimulating hormone (TSH). Several alternatively spliced transcript variants encoding the same protein have been observed for this gene. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of THRB. |
| Description | 8bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TTTCTTCTCCTCCGTTTGGA |
| PCR Primer |
Forward: AAAGAACAGTTGGAGAAAACATGGG Reverse: TGGAAGCTAGTAGGAATGTCTGAAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.