Them4 cDNA ORF Clone, Rat, C-Myc tag - CD BioSciences

service-banner

Them4 cDNA ORF Clone, Rat, C-Myc tag

Them4 cDNA ORF Clone, Rat, C-Myc tag

SPD-04061

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat thioesterase superfamily member 4 with C terminal Myc tag.
Target Information
Species Rat
Target Name CTMP
Gene Abbr. Them4
Gene ID 361992
Full Name thioesterase superfamily member 4
Alias RGD1304723
Introduction Carboxyl-terminal modulator protein (CTMP) is a negative regulator of Akt and was identified as an Akt binding protein. Akt, also referred to as PKB or Rac, plays a critical role in controlling the balance between survival and apoptosis. This protein kinase, activated by insulin and various growth and survival factors, functions in a wortmannin-sensitive pathway involving PI3 kinase. Akt is activated by phospholipid binding and activation loop phosphorylation at Thr308 by PDK1 and by phosphorylation within the carboxy-terminus at Ser473. CTMP binds to the regulatory domain of Akt at the carboxy terminus of the protein and inhibits phosphorylation on Thr308 and Ser473.
Product Details
Description Full length Clone DNA of Rat thioesterase superfamily member 4 with C terminal Myc tag.
NCBI Ref Seq NM_001025017.1
RefSeq ORF Size 693 bp
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.