Online Inquiry
Them4 cDNA ORF Clone, Mouse, C-His tag
SPD-04050
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse thioesterase superfamily member 4 with C terminal His tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | CTMP |
Gene Abbr. | Them4 |
Gene ID | 75778 |
Full Name | thioesterase superfamily member 4 |
Alias | 2700077M13Rik, 4921507I02Rik |
Introduction | Carboxyl-terminal modulator protein (CTMP) is a negative regulator of Akt and was identified as an Akt binding protein. Akt, also referred to as PKB or Rac, plays a critical role in controlling the balance between survival and apoptosis. This protein kinase, activated by insulin and various growth and survival factors, functions in a wortmannin-sensitive pathway involving PI3 kinase. Akt is activated by phospholipid binding and activation loop phosphorylation at Thr308 by PDK1 and by phosphorylation within the carboxy-terminus at Ser473. CTMP binds to the regulatory domain of Akt at the carboxy terminus of the protein and inhibits phosphorylation on Thr308 and Ser473. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse thioesterase superfamily member 4 with C terminal His tag. |
NCBI Ref Seq | NM_029431.1 |
RefSeq ORF Size | 693 bp |
Vector | pCMV3-C-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.