Online Inquiry
Th cDNA ORF Clone, Mouse, C-HA tag
SPD-15353
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse tyrosine hydroxylase with C terminal HA tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | Tyrosine Hydroxylase |
Gene Abbr. | Th |
Gene ID | 21823 |
Full Name | tyrosine hydroxylase |
Introduction | Tyrosine hydroxylase (TH) catalyzes the rate-limiting step in the synthesis of the neurotransmitter dopamine and other catecholamines. TH functions as a tetramer, with each subunit composed of a regulatory and catalytic domain, and exists in several different isoforms. This enzyme is required for embryonic development since TH knockout mice die before or at birth. Levels of transcription, translation and posttranslational modification regulate TH activity. The amino-terminal regulatory domain contains three serine residues: Ser9, Ser31 and Ser40. Phosphorylation at Ser40 by PKA positively regulates the catalytic activity of TH. Phosphorylation at Ser31 by CDK5 also increases the catalytic activity of TH through stabilization of TH protein levels. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse tyrosine hydroxylase with C terminal HA tag. |
NCBI Ref Seq | NM_009377.1 |
RefSeq ORF Size | 1497 bp |
Vector | pCMV3-C-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.