TH cDNA ORF Clone, Human, N-HA tag - CD BioSciences

service-banner

TH cDNA ORF Clone, Human, N-HA tag

TH cDNA ORF Clone, Human, N-HA tag

SPD-15368

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human tyrosine hydroxylase, transcript variant 2 with N terminal HA tag.
Target Information
Species Human
Target Name Tyrosine Hydroxylase
Gene Abbr. TH
Gene ID 7054
Full Name tyrosine hydroxylase
Alias DYT14, DYT5b, TYH
Introduction Tyrosine hydroxylase (TH) catalyzes the rate-limiting step in the synthesis of the neurotransmitter dopamine and other catecholamines. TH functions as a tetramer, with each subunit composed of a regulatory and catalytic domain, and exists in several different isoforms. This enzyme is required for embryonic development since TH knockout mice die before or at birth. Levels of transcription, translation and posttranslational modification regulate TH activity. The amino-terminal regulatory domain contains three serine residues: Ser9, Ser31 and Ser40. Phosphorylation at Ser40 by PKA positively regulates the catalytic activity of TH. Phosphorylation at Ser31 by CDK5 also increases the catalytic activity of TH through stabilization of TH protein levels.
Product Details
Description Full length Clone DNA of Human tyrosine hydroxylase, transcript variant 2 with N terminal HA tag.
NCBI Ref Seq NM_000360.3
RefSeq ORF Size 1494 bp
Vector pCMV3-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.