Online Inquiry
TGFBR2 Knockout Cell Line
SPL-03629
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
7bp deletion |
Target Information | |
---|---|
Target Name | TGF-β Receptor |
Gene Abbr. | TGFBR2 |
Gene ID | 7048 |
Full Name | transforming growth factor beta receptor 2 |
Alias | AAT3, FAA3, LDS1B, LDS2, LDS2B |
Species | Human |
Genomic Locus | chr3:30606958 |
Transcript | NM_003242 |
WT Expression Level | 3.87 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a member of the Ser/Thr protein kinase family and the TGFB receptor subfamily. The encoded protein is a transmembrane protein that has a protein kinase domain, forms a heterodimeric complex with another receptor protein, and binds TGF-beta. This receptor/ligand complex phosphorylates proteins, which then enter the nucleus and regulate the transcription of a subset of genes related to cell proliferation. Mutations in this gene have been associated with Marfan Syndrome, Loeys-Deitz Aortic Aneurysm Syndrome, and the development of various types of tumors. Alternatively spliced transcript variants encoding different isoforms have been characterized. [provided by RefSeq, Jul 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of TGFBR2. |
Description | 7bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | CCGACTTCTGAACGTGCGGT |
PCR Primer |
Forward: CTCGGTCTATGACGAGCAGC Reverse: GAAACTTTCCTCGTTTCCGCC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.