TGFBR2 Knockout Cell Line - CD BioSciences

service-banner

TGFBR2 Knockout Cell Line

TGFBR2 Knockout Cell Line

SPL-03624

Size Price
1 Unit Online Inquiry
Description
10bp deletion
Target Information
Target Name TGF-β Receptor
Gene Abbr. TGFBR2
Gene ID 7048
Full Name transforming growth factor beta receptor 2
Alias AAT3, FAA3, LDS1B, LDS2, LDS2B
Species Human
Genomic Locus chr3:30671740
Transcript NM_003242
WT Expression Level 3.87 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the Ser/Thr protein kinase family and the TGFB receptor subfamily. The encoded protein is a transmembrane protein that has a protein kinase domain, forms a heterodimeric complex with another receptor protein, and binds TGF-beta. This receptor/ligand complex phosphorylates proteins, which then enter the nucleus and regulate the transcription of a subset of genes related to cell proliferation. Mutations in this gene have been associated with Marfan Syndrome, Loeys-Deitz Aortic Aneurysm Syndrome, and the development of various types of tumors. Alternatively spliced transcript variants encoding different isoforms have been characterized. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of TGFBR2.
Description 10bp deletion
Parental Cell Line C631
Guide RNA Sequence TCTACTGCTACCGCGTTAAC
PCR Primer Forward: CCTTGTTTTGTTTCCCCATCAGAAT
Reverse: GTCTCAAACTGCTCTGAAGTGTTC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.