TGFBR1 Knockout Cell Line - CD BioSciences

service-banner

TGFBR1 Knockout Cell Line

TGFBR1 Knockout Cell Line

SPL-03623

Size Price
1 Unit Online Inquiry
Description
5bp deletion
Target Information
Target Name TGF-β Receptor
Gene Abbr. TGFBR1
Gene ID 7046
Full Name transforming growth factor beta receptor 1
Alias AAT5, ACVRLK4, ALK-5, ALK5, ESS1
Species Human
Genomic Locus chr9:99137912
Transcript NM_001130916
WT Expression Level 16.99 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene forms a heteromeric complex with type II TGF-beta receptors when bound to TGF-beta, transducing the TGF-beta signal from the cell surface to the cytoplasm. The encoded protein is a serine/threonine protein kinase. Mutations in this gene have been associated with Loeys-Dietz aortic aneurysm syndrome (LDAS). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of TGFBR1.
Description 5bp deletion
Parental Cell Line C631
Guide RNA Sequence AGCATTGGCAAAGGTCGATT
PCR Primer Forward: GGGTCACTCATTAGTGCCTATC
Reverse: TAAATCTCTGCCTCACGGAACC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.