TGFB2 cDNA ORF Clone, Rhesus, C-His tag - CD BioSciences

service-banner

TGFB2 cDNA ORF Clone, Rhesus, C-His tag

TGFB2 cDNA ORF Clone, Rhesus, C-His tag

SPD-14577

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus transforming growth factor, beta 2 with C terminal His tag.
Target Information
Species Rhesus
Target Name TGF-β
Gene Abbr. TGFB2
Gene ID 707540
Full Name transforming growth factor beta 2
Introduction Transforming growth factor-β (TGF-β) superfamily members are critical regulators of cell proliferation and differentiation, developmental patterning and morphogenesis, and disease pathogenesis. TGF-β elicits signaling through three cell surface receptors: type I type II (RII), and type III (RIII). Type I and type II receptors are serine/threonine kinases that form a heteromeric complex. In response to ligand binding, the type II receptors form a stable complex with the type I receptors allowing phosphorylation and activation of type I receptor kinases. The type III receptor, also known as betaglycan, is a transmembrane proteoglycan with a large extracellular domain that binds TGF-β with high affinity but lacks a cytoplasmic signaling domain. Expression of the type III receptor can regulate TGF-β signaling through presentation of the ligand to the signaling complex. The only known direct TGF-β signaling effectors are the Smad family proteins, which transduce signals from the cell surface directly to the nucleus to regulate target gene transcription.Three isoforms of TGF-β, designated TGF-β1, TGF-β2 and TGF-β3, are encoded by distinct genes and are expressed in a tissue specific manner. Each isoform is synthesized as a larger precursor protein containing a propeptide region that is removed prior to secretion. Mature TGF-β contains two polypeptides linked by disulfide bonds to form a protein of approximately 25 kDa.
Product Details
Description Full length Clone DNA of Rhesus transforming growth factor, beta 2 with C terminal His tag.
NCBI Ref Seq XM_001103911.2
RefSeq ORF Size 1245 bp
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.