Online Inquiry
TGFB2 cDNA ORF Clone, Human, N-Myc tag
SPD-14604
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human transforming growth factor, beta 2 (TGFB2), transcript variant 2 with N terminal Myc tag. |
Target Information | |
---|---|
Species | Human |
Target Name | TGF-β |
Gene Abbr. | TGFB2 |
Gene ID | 7042 |
Full Name | transforming growth factor beta 2 |
Alias | G-TSF, LDS4, TGF-beta2 |
Introduction | Transforming growth factor-β (TGF-β) superfamily members are critical regulators of cell proliferation and differentiation, developmental patterning and morphogenesis, and disease pathogenesis. TGF-β elicits signaling through three cell surface receptors: type I type II (RII), and type III (RIII). Type I and type II receptors are serine/threonine kinases that form a heteromeric complex. In response to ligand binding, the type II receptors form a stable complex with the type I receptors allowing phosphorylation and activation of type I receptor kinases. The type III receptor, also known as betaglycan, is a transmembrane proteoglycan with a large extracellular domain that binds TGF-β with high affinity but lacks a cytoplasmic signaling domain. Expression of the type III receptor can regulate TGF-β signaling through presentation of the ligand to the signaling complex. The only known direct TGF-β signaling effectors are the Smad family proteins, which transduce signals from the cell surface directly to the nucleus to regulate target gene transcription.Three isoforms of TGF-β, designated TGF-β1, TGF-β2 and TGF-β3, are encoded by distinct genes and are expressed in a tissue specific manner. Each isoform is synthesized as a larger precursor protein containing a propeptide region that is removed prior to secretion. Mature TGF-β contains two polypeptides linked by disulfide bonds to form a protein of approximately 25 kDa. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human transforming growth factor, beta 2 (TGFB2), transcript variant 2 with N terminal Myc tag. |
NCBI Ref Seq | NM_003238.3 |
RefSeq ORF Size | 1245 bp |
Vector | pCMV3-SP-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.