Online Inquiry
TGFB1 cDNA ORF Clone, Human, C-Myc tag
SPD-14558
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human transforming growth factor, beta 1 with C terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | TGF-β |
| Gene Abbr. | TGFB1 |
| Gene ID | 7040 |
| Full Name | transforming growth factor beta 1 |
| Alias | CED, DPD1, IBDIMDE, LAP, TGF-beta1 |
| Introduction | Transforming growth factor-β (TGF-β) superfamily members are critical regulators of cell proliferation and differentiation, developmental patterning and morphogenesis, and disease pathogenesis. TGF-β elicits signaling through three cell surface receptors: type I type II (RII), and type III (RIII). Type I and type II receptors are serine/threonine kinases that form a heteromeric complex. In response to ligand binding, the type II receptors form a stable complex with the type I receptors allowing phosphorylation and activation of type I receptor kinases. The type III receptor, also known as betaglycan, is a transmembrane proteoglycan with a large extracellular domain that binds TGF-β with high affinity but lacks a cytoplasmic signaling domain. Expression of the type III receptor can regulate TGF-β signaling through presentation of the ligand to the signaling complex. The only known direct TGF-β signaling effectors are the Smad family proteins, which transduce signals from the cell surface directly to the nucleus to regulate target gene transcription.There are three TGF-beta family members, designated TGF-β1, TGF-β2, and TGF-β3, which are encoded by distinct genes and are expressed in a tissue specific manner. TGF-β proteins are synthesized as precursor proteins that are cleaved and reassembled in association with other proteins to form latent complexes. Activation occurs by proteolytic release of TGF-β monomers, which dimerize to form the mature TGF-β ligands. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human transforming growth factor, beta 1 with C terminal Myc tag. |
| NCBI Ref Seq | NM_000660.4 |
| RefSeq ORF Size | 1173 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-C-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Restriction Sites | HindIII + XbaI (6kb + 1.22kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.