TF cDNA ORF Clone, Human, N-Myc tag - CD BioSciences

service-banner

TF cDNA ORF Clone, Human, N-Myc tag

TF cDNA ORF Clone, Human, N-Myc tag

SPD-15293

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human transferrin with N terminal Myc tag.
Target Information
Species Human
Target Name Transferrin
Gene Abbr. TF
Gene ID 7018
Full Name transferrin
Alias HEL-S-71p, PRO1557, PRO2086, TFQTL1
Introduction Transferrin is a single polypeptide chain glycoprotein and is a member of the iron binding family of proteins. It has a molecular weight of 77 kDa and a serum concentration range of 1800 to 2700 mg/L. It is synthesised in the liver and consists of two domains each having a high affinity reversible binding site for Fe3+. The iron is transported in blood and interstitial fluids to sites of use and disposal. Iron/transferrin is essential in haemoglobin synthesis and for certain types of cell division. Serum concentration rises in iron deficiency and pregnancy and falls in iron overload, infection and inflammatory conditions. The function of transferrin is to transport iron from the intestine, reticuloendothelial system, and liver parenchymal cells to all proliferating cells in the body. In addition to its function in iron transport, this protein may also have a physiologic role as granulocyte/pollen binding protein (GPBP) involved in the removal of certain organic matter/allergins from serum.
Product Details
Description Full length Clone DNA of Human transferrin with N terminal Myc tag.
NCBI Ref Seq NM_001063.2
RefSeq ORF Size 2097 bp
Vector pCMV3-SP-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.