TET2 Knockout Cell Line - CD BioSciences

service-banner

TET2 Knockout Cell Line

TET2 Knockout Cell Line

SPL-03614

Size Price
1 Unit Online Inquiry
Description
5bp deletion
Target Information
Target Name TET2
Gene Abbr. TET2
Gene ID 54790
Full Name tet methylcytosine dioxygenase 2
Alias KIAA1546, MDS
Species Human
Genomic Locus chr4:105234152
Transcript NM_001127208
WT Expression Level 4.42 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a methylcytosine dioxygenase that catalyzes the conversion of methylcytosine to 5-hydroxymethylcytosine. The encoded protein is involved in myelopoiesis, and defects in this gene have been associated with several myeloproliferative disorders. Two variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of TET2.
Description 5bp deletion
Parental Cell Line C631
Guide RNA Sequence CAGGACTCACACGACTATTC
PCR Primer Forward: TAAGTCCATTCCTGATACCATCACC
Reverse: CGAAGTTACGTCTTTCTCCATTAGC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.