Online Inquiry
TESK2 Knockout Cell Line
SPL-03609
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 7bp deletion |
| Target Information | |
|---|---|
| Target Name | TESK2 |
| Gene Abbr. | TESK2 |
| Gene ID | 10420 |
| Full Name | testis associated actin remodelling kinase 2 |
| Species | Human |
| Genomic Locus | chr1:45457612 |
| Transcript | NM_007170 |
| WT Expression Level | 3.74 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene product is a serine/threonine protein kinase that contains an N-terminal protein kinase domain that is structurally similar to the kinase domains of testis-specific protein kinase-1 and the LIM motif-containing protein kinases (LIMKs). Its overall structure is most related to the former, indicating that it belongs to the TESK subgroup of the LIMK/TESK family of protein kinases. This gene is predominantly expressed in testis and prostate. The developmental expression pattern of the rat gene in testis suggests an important role for this gene in meitoic stages and/or early stages of spermiogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of TESK2. |
| Description | 7bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ATCATCCAAACGCGTCAGTC |
| PCR Primer |
Forward: TGTAAAACGACGGCCAGCTATCAACCTGCAGTAAATGTGACC Reverse: TGTTTCCTAGAAAGTAGGTGCTCAA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.