TESK1 Knockout Cell Line - CD BioSciences

service-banner

TESK1 Knockout Cell Line

TESK1 Knockout Cell Line

SPL-03607

Size Price
1 Unit Online Inquiry
Description
8bp deletion
Target Information
Target Name TESK1
Gene Abbr. TESK1
Gene ID 7016
Full Name testis associated actin remodelling kinase 1
Species Human
Genomic Locus chr9:35606952
Transcript NM_006285
WT Expression Level 8.83 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene product is a serine/threonine protein kinase that contains an N-terminal protein kinase domain and a C-terminal proline-rich domain. Its protein kinase domain is most closely related to those of the LIM motif-containing protein kinases (LIMKs). The encoded protein can phosphorylate myelin basic protein and histone in vitro. The testicular germ cell-specific expression and developmental pattern of expression of the mouse gene suggests that this gene plays an important role at and after the meiotic phase of spermatogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of TESK1.
Description 8bp deletion
Parental Cell Line C631
Guide RNA Sequence GTCGCGGTGAAATACACCTT
PCR Primer Forward: ATATTGCAACATCATCCAACACTCC
Reverse: GACTGAAGTCTGACATCTATTCCCA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.