Online Inquiry
TEK Knockout Cell Line
SPL-03602
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 50bp deletion |
| Target Information | |
|---|---|
| Target Name | Tie2 |
| Gene Abbr. | TEK |
| Gene ID | 7010 |
| Full Name | TEK receptor tyrosine kinase |
| Alias | CD202B, GLC3E, TIE-2, TIE2, VMCM |
| Species | Human |
| Genomic Locus | chr9:27169490 |
| Transcript | NM_000459 |
| WT Expression Level | 0.05 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a receptor that belongs to the protein tyrosine kinase Tie2 family. The encoded protein possesses a unique extracellular region that contains two immunoglobulin-like domains, three epidermal growth factor (EGF)-like domains and three fibronectin type III repeats. The ligand angiopoietin-1 binds to this receptor and mediates a signaling pathway that functions in embryonic vascular development. Mutations in this gene are associated with inherited venous malformations of the skin and mucous membranes. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 50bp deletion in a coding exon of TEK. |
| Description | 50bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CTTCATGCCGGGGCACTGAA |
| PCR Primer |
Forward: TTCAGCATTTTCATTCTTCTCCCAC Reverse: TGCTTAAGAAGCCATGGTTAGTTTC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.