Online Inquiry
TDP1 Knockout Cell Line
SPL-03593
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
13bp deletion |
Target Information | |
---|---|
Target Name | TDP1 |
Gene Abbr. | TDP1 |
Gene ID | 55775 |
Full Name | tyrosyl-DNA phosphodiesterase 1 |
Species | Human |
Genomic Locus | chr14:89963609 |
Transcript | NM_018319 |
WT Expression Level | 21.17 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | The protein encoded by this gene is involved in repairing stalled topoisomerase I-DNA complexes by catalyzing the hydrolysis of the phosphodiester bond between the tyrosine residue of topoisomerase I and the 3-prime phosphate of DNA. This protein may also remove glycolate from single-stranded DNA containing 3-prime phosphoglycolate, suggesting a role in repair of free-radical mediated DNA double-strand breaks. This gene is a member of the phospholipase D family and contains two PLD phosphodiesterase domains. Mutations in this gene are associated with the disease spinocerebellar ataxia with axonal neuropathy (SCAN1). [provided by RefSeq, Aug 2016]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 13bp deletion in a coding exon of TDP1. |
Description | 13bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | AGACTCTAGTGAGGTAAAAC |
PCR Primer |
Forward: TCTGCCTGAGTTAAGTAAACAGTCT Reverse: CACTGCCCAAAGAACTGAAAATCAT |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.