Online Inquiry
TDG Knockout Cell Line
SPL-03589
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 13bp deletion |
| Target Information | |
|---|---|
| Target Name | TDG |
| Gene Abbr. | TDG |
| Gene ID | 6996 |
| Full Name | thymine DNA glycosylase |
| Alias | hTDG |
| Species | Human |
| Genomic Locus | chr12:103982836 |
| Transcript | NM_003211 |
| WT Expression Level | 74.02 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene belongs to the TDG/mug DNA glycosylase family. Thymine-DNA glycosylase (TDG) removes thymine moieties from G/T mismatches by hydrolyzing the carbon-nitrogen bond between the sugar-phosphate backbone of DNA and the mispaired thymine. With lower activity, this enzyme also removes thymine from C/T and T/T mispairings. TDG can also remove uracil and 5-bromouracil from mispairings with guanine. This enzyme plays a central role in cellular defense against genetic mutation caused by the spontaneous deamination of 5-methylcytosine and cytosine. This gene may have a pseudogene in the p arm of chromosome 12. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 13bp deletion in a coding exon of TDG. |
| Description | 13bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GATCATCCATATGGTTCAGC |
| PCR Primer |
Forward: ACCCCCTGTGAAAAGGAGATAATAA Reverse: AGGTTCCAACCCATAAAAGCAAATG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.