Online Inquiry
Tbk1 cDNA ORF Clone, Mouse, untagged
SPD-14465
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse TANK-binding kinase 1 |
Target Information | |
---|---|
Species | Mouse |
Target Name | TBK1/NAK |
Gene Abbr. | Tbk1 |
Gene ID | 56480 |
Full Name | TANK-binding kinase 1 |
Alias | 1200008B05Rik, AI462036, AW048562 |
Introduction | TBK1 (TANK-binding kinase 1)/NAK (NF-κB activating kinase) is an IκB kinase (IKK)-activating kinase and can activate IKK through direct phosphorylation. TBK1 was identified through association with the TRAF binding protein, TANK, and found to function upstream of NIK and IKK in the activation of NF-κB. TBK1 induces IκB degradation and NF-κB activity through IKKβ. TBK1 may mediate IKK and NF-κB activation in response to growth factors that stimulate PKCε activity. TBK1 plays a pivotal role in the activation of IRF3 in the innate immune response. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse TANK-binding kinase 1 |
NCBI Ref Seq | NM_019786.4 |
RefSeq ORF Size | 2190 bp |
Vector | pCMV3-untagged |
Promoter | Enhanced CMV promoter |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Ampicillin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.