Tbk1 cDNA ORF Clone, Mouse, N-His tag - CD BioSciences

service-banner

Tbk1 cDNA ORF Clone, Mouse, N-His tag

Tbk1 cDNA ORF Clone, Mouse, N-His tag

SPD-14461

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse TANK-binding kinase 1 with N terminal His tag.
Target Information
Species Mouse
Target Name TBK1/NAK
Gene Abbr. Tbk1
Gene ID 56480
Full Name TANK-binding kinase 1
Alias 1200008B05Rik, AI462036, AW048562
Introduction TBK1 (TANK-binding kinase 1)/NAK (NF-κB activating kinase) is an IκB kinase (IKK)-activating kinase and can activate IKK through direct phosphorylation. TBK1 was identified through association with the TRAF binding protein, TANK, and found to function upstream of NIK and IKK in the activation of NF-κB. TBK1 induces IκB degradation and NF-κB activity through IKKβ. TBK1 may mediate IKK and NF-κB activation in response to growth factors that stimulate PKCε activity. TBK1 plays a pivotal role in the activation of IRF3 in the innate immune response.
Product Details
Description Full length Clone DNA of Mouse TANK-binding kinase 1 with N terminal His tag.
NCBI Ref Seq NM_019786.4
RefSeq ORF Size 2190 bp
Vector pCMV3-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.