Online Inquiry
TAOK3 Knockout Cell Line
SPL-03578
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 5bp deletion |
| Target Information | |
|---|---|
| Target Name | TAO Kinase |
| Gene Abbr. | TAOK3 |
| Gene ID | 51347 |
| Full Name | TAO kinase 3 |
| Alias | DPK, JIK, MAP3K18, hKFC-A |
| Species | Human |
| Genomic Locus | chr12:118235615 |
| Transcript | NM_016281 |
| WT Expression Level | 18.49 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a serine/threonine protein kinase that activates the p38/MAPK14 stress-activated MAPK cascade but inhibits the basal activity of the MAPK8/JNK cascade. The encoded protein is a member of the GCK subfamily of STE20-like kinases. [provided by RefSeq, Oct 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of TAOK3. |
| Description | 5bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TCAGCTAGTTTTACCTGACC |
| PCR Primer |
Forward: TGTAAAACGACGGCCAGCCAGAGTGTTTCTTTTTATGCCAGT Reverse: TAAATCTCCTTCTGGCTATCTGAGC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.