TAOK3 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

TAOK3 cDNA ORF Clone, Human, untagged

TAOK3 cDNA ORF Clone, Human, untagged

SPD-14430

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human TAO kinase 3.
Target Information
Species Human
Target Name TAO Kinase
Gene Abbr. TAOK3
Gene ID 51347
Full Name TAO kinase 3
Alias DPK, JIK, MAP3K18, hKFC-A
Introduction JIK belongs to the Ser/Thr protein kinase family. JIK inhibits the basal activity of Jun kinase and is negatively regulated by epidermal growth factor (EGF). When over expressed, JIK may activate ERK1/ERK2 and JNK/SAPK.
Product Details
Description Full length Clone DNA of Human TAO kinase 3.
NCBI Ref Seq NM_016281.3
RefSeq ORF Size 2697 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.