Online Inquiry
TAOK3 cDNA ORF Clone, Human, C-Myc tag
SPD-14423
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human TAO kinase 3 with C terminal Myc tag. |
Target Information | |
---|---|
Species | Human |
Target Name | TAO Kinase |
Gene Abbr. | TAOK3 |
Gene ID | 51347 |
Full Name | TAO kinase 3 |
Alias | DPK, JIK, MAP3K18, hKFC-A |
Introduction | JIK belongs to the Ser/Thr protein kinase family. JIK inhibits the basal activity of Jun kinase and is negatively regulated by epidermal growth factor (EGF). When over expressed, JIK may activate ERK1/ERK2 and JNK/SAPK. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human TAO kinase 3 with C terminal Myc tag. |
NCBI Ref Seq | NM_016281.3 |
RefSeq ORF Size | 2697 bp |
Vector | pCMV3-C-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.