Online Inquiry
TAB3 Knockout Cell Line
SPL-03571
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | TAB3 |
| Gene Abbr. | TAB3 |
| Gene ID | 257397 |
| Full Name | TGF-beta activated kinase 1 (MAP3K7) binding protein 3 |
| Alias | MAP3K7IP3, NAP1 |
| Species | Human |
| Genomic Locus | chrX:30854985 |
| Transcript | NM_152787 |
| WT Expression Level | 14.23 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The product of this gene functions in the NF-kappaB signal transduction pathway. The encoded protein, and the similar and functionally redundant protein MAP3K7IP2/TAB2, forms a ternary complex with the protein kinase MAP3K7/TAK1 and either TRAF2 or TRAF6 in response to stimulation with the pro-inflammatory cytokines TNF or IL-1. Subsequent MAP3K7/TAK1 kinase activity triggers a signaling cascade leading to activation of the NF-kappaB transcription factor. The human genome contains a related pseudogene. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of TAB3. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GGAGACCCATAGAGATTGCT |
| PCR Primer |
Forward: GTTGGTGTGGATAAACAGGTAAAGG Reverse: TTATGAACGAACAGAACAGAAGTGC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.