Online Inquiry
TAB1 Knockout Cell Line
SPL-03569
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | TAB1 |
| Gene Abbr. | TAB1 |
| Gene ID | 10454 |
| Full Name | TGF-beta activated kinase 1 (MAP3K7) binding protein 1 |
| Alias | 3'-Tab1, MAP3K7IP1 |
| Species | Human |
| Genomic Locus | chr22:39415525 |
| Transcript | NM_006116 |
| WT Expression Level | 14.61 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene was identified as a regulator of the MAP kinase kinase kinase MAP3K7/TAK1, which is known to mediate various intracellular signaling pathways, such as those induced by TGF beta, interleukin 1, and WNT-1. This protein interacts and thus activates TAK1 kinase. It has been shown that the C-terminal portion of this protein is sufficient for binding and activation of TAK1, while a portion of the N-terminus acts as a dominant-negative inhibitor of TGF beta, suggesting that this protein may function as a mediator between TGF beta receptors and TAK1. This protein can also interact with and activate the mitogen-activated protein kinase 14 (MAPK14/p38alpha), and thus represents an alternative activation pathway, in addition to the MAPKK pathways, which contributes to the biological responses of MAPK14 to various stimuli. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of TAB1. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GGGGTCTTCAACGGCTATGA |
| PCR Primer |
Forward: CAGAGTGAAATGATGGCTAAAGCAG Reverse: CAACCCTGGCAACATGCTAGA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.