Online Inquiry
TAB1 cDNA ORF Clone, Human, N-FLAG tag
SPD-14378
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human TGF-beta activated kinase 1/MAP3K7 binding protein 1 with N terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | TAB1 |
Gene Abbr. | TAB1 |
Gene ID | 10454 |
Full Name | TGF-beta activated kinase 1 (MAP3K7) binding protein 1 |
Alias | 3'-Tab1, MAP3K7IP1 |
Introduction | TAK1 is a mitogen-activated protein kinase kinase kinase activated by TGF-β and various pro-inflammatory signals. In vivo, TAK1 activation requires its association with TAK1 binding protein 1 (TAB1), which triggers TAK1 autophosphorylation at Thr184 and Thr187. The TAB2 adaptor protein links TAK1 with TRAF6 to mediate TAK1 activation following IL-1 stimulation. Once activated, TAK1 phosphorylates the MAPK kinases MKK4 and MKK3/6, which activate JNK and p38 MAPK, respectively. TAK1 and TRAF6 also activate the NF-κB pathway by phosphorylating the NF-κB inducing kinase (NIK) to trigger subsequent activation of IKK. In addition to TAK1, TAB1 interacts with and activates p38α MAPK. Targeted disruption of the TAB1 gene in mice causes a drastic reduction in TAK1 activity and leads to embryonic lethality. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human TGF-beta activated kinase 1/MAP3K7 binding protein 1 with N terminal Flag tag. |
NCBI Ref Seq | NM_006116.2 |
RefSeq ORF Size | 1554 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | KpnI + XbaI (6kb + 1.55kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.