TAB1 cDNA ORF Clone, Human, C-FLAG tag - CD BioSciences

service-banner

TAB1 cDNA ORF Clone, Human, C-FLAG tag

TAB1 cDNA ORF Clone, Human, C-FLAG tag

SPD-14374

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human TGF-beta activated kinase 1/MAP3K7 binding protein 1 with C terminal Flag tag.
Target Information
Species Human
Target Name TAB1
Gene Abbr. TAB1
Gene ID 10454
Full Name TGF-beta activated kinase 1 (MAP3K7) binding protein 1
Alias 3'-Tab1, MAP3K7IP1
Introduction TAK1 is a mitogen-activated protein kinase kinase kinase activated by TGF-β and various pro-inflammatory signals. In vivo, TAK1 activation requires its association with TAK1 binding protein 1 (TAB1), which triggers TAK1 autophosphorylation at Thr184 and Thr187. The TAB2 adaptor protein links TAK1 with TRAF6 to mediate TAK1 activation following IL-1 stimulation. Once activated, TAK1 phosphorylates the MAPK kinases MKK4 and MKK3/6, which activate JNK and p38 MAPK, respectively. TAK1 and TRAF6 also activate the NF-κB pathway by phosphorylating the NF-κB inducing kinase (NIK) to trigger subsequent activation of IKK. In addition to TAK1, TAB1 interacts with and activates p38α MAPK. Targeted disruption of the TAB1 gene in mice causes a drastic reduction in TAK1 activity and leads to embryonic lethality.
Product Details
Description Full length Clone DNA of Human TGF-beta activated kinase 1/MAP3K7 binding protein 1 with C terminal Flag tag.
NCBI Ref Seq NM_006116.2
RefSeq ORF Size 1554 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 1.55kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.