Online Inquiry
SZT2 Knockout Cell Line
SPL-03567
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 79bp deletion |
| Target Information | |
|---|---|
| Target Name | SZT2 |
| Gene Abbr. | SZT2 |
| Gene ID | 23334 |
| Full Name | SZT2 subunit of KICSTOR complex |
| Alias | C1orf84, DEE18, EIEE18, KIAA0467, SZT2A |
| Species | Human |
| Genomic Locus | chr1:43403745 |
| Transcript | NM_015284 |
| WT Expression Level | 6.45 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is expressed in the brain, predominantly in the parietal and frontal cortex as well as in dorsal root ganglia. It is localized to the peroxisome, and is implicated in resistance to oxidative stress. It likely functions by increasing superoxide dismutase (SOD) activity, but itself has no direct SOD activity. Studies in mice show that this gene confers low seizure threshold, and may also enhance epileptogenesis. [provided by RefSeq, Jun 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 79bp deletion in a coding exon of SZT2. |
| Description | 79bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TTGGACCTTAGCCCATCTAC |
| PCR Primer |
Forward: TCATTTGGGATATAGAAGGCAGGTC Reverse: CACCCATCATTCCTTTATAAGCCTG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.