SYNJ1 Knockout Cell Line - CD BioSciences

service-banner

SYNJ1 Knockout Cell Line

SYNJ1 Knockout Cell Line

SPL-03558

Size Price
1 Unit Online Inquiry
Description
14bp deletion
Target Information
Target Name Synaptojanin 1
Gene Abbr. SYNJ1
Gene ID 8867
Full Name synaptojanin 1
Alias DEE53, EIEE53, INPP5G, PARK20
Species Human
Genomic Locus chr21:32702003
Transcript NM_001160306
WT Expression Level 7.91 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a phosphoinositide phosphatase that regulates levels of membrane phosphatidylinositol-4,5-bisphosphate. As such, expression of this enzyme may affect synaptic transmission and membrane trafficking. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 14bp deletion in a coding exon of SYNJ1.
Description 14bp deletion
Parental Cell Line C631
Guide RNA Sequence GGGTACATACTCCAAAGTAC
PCR Primer Forward: TCATAGCTAGTCCCTCTCAAATCCT
Reverse: TCAGATCAGTGGACAGGATGGATTA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.