Online Inquiry
SYN1 cDNA ORF Clone, Human, untagged
SPD-14362
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human synapsin I |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Synapsin |
| Gene Abbr. | SYN1 |
| Gene ID | 6853 |
| Full Name | synapsin I |
| Alias | MRX50, SYN1a, SYN1b, SYNI |
| Introduction | Synapsins, a group of at least five related members (synapsins Ia, Ib, IIa, IIb, and IIIa), are abundant brain proteins essential for regulating neurotransmitter release. All synapsins contain a short amino-terminal domain that is highly conserved and phosphorylated by PKA or CaM kinase I. Phosphorylation of the synapsin amino-terminal domain at Ser9 inhibits its binding to phospholipids and dissociates synapsins from synaptic vesicles. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human synapsin I |
| NCBI Ref Seq | NM_006950.3 |
| RefSeq ORF Size | 2118 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV mammalian cell promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 2.12kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.