Online Inquiry
SYK Knockout Cell Line
SPL-03555
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 29bp deletion |
| Target Information | |
|---|---|
| Target Name | SYK |
| Gene Abbr. | SYK |
| Gene ID | 6850 |
| Full Name | spleen associated tyrosine kinase |
| Alias | p72-Syk |
| Species | Human |
| Genomic Locus | chr9:90844022 |
| Transcript | NM_003177 |
| WT Expression Level | 9.23 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the family of non-receptor type Tyr protein kinases. This protein is widely expressed in hematopoietic cells and is involved in coupling activated immunoreceptors to downstream signaling events that mediate diverse cellular responses, including proliferation, differentiation, and phagocytosis. It is thought to be a modulator of epithelial cell growth and a potential tumour suppressor in human breast carcinomas. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 29bp deletion in a coding exon of SYK. |
| Description | 29bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CGCCAGAGCCGCAACTACCT |
| PCR Primer |
Forward: ACCAAAGTTCTCTGTCTCTGTCTTG Reverse: ATGGTGTAGTGGTGTGCCTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.