Online Inquiry
SYK cDNA ORF Clone, Human, N-Myc tag
SPD-14357
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human spleen tyrosine kinase , transcript variant 1 with N terminal Myc tag. |
Target Information | |
---|---|
Species | Human |
Target Name | SYK |
Gene Abbr. | SYK |
Gene ID | 6850 |
Full Name | spleen associated tyrosine kinase |
Alias | p72-Syk |
Introduction | Syk is a protein tyrosine kinase that plays an important role in intracellular signal transduction in hematopoietic cells. Syk interacts with immunoreceptor tyrosine-based activation motifs (ITAMs) located in the cytoplasmic domains of immune receptors. It couples the activated immunoreceptors to downstream signaling events that mediate diverse cellular responses, including proliferation, differentiation, and phagocytosis. There is also evidence of a role for Syk in nonimmune cells and investigators have indicated that Syk is a potential tumor suppressor in human breast carcinomas. Tyr323 is a negative regulatory phosphorylation site within the SH2-kinase linker region in Syk. Phosphorylation at Tyr323 provides a direct binding site for the TKB domain of Cbl. Tyr352 of Syk is involved in the association of PLCγ1. Tyr525 and Tyr526 are located in the activation loop of the Syk kinase domain; phosphorylation at Tyr525/526 of human Syk (equivalent to Tyr519/520 of mouse Syk) is essential for Syk function.Ser297 of human Syk protein-tyrosine kinase (corresponding to mouse Syk residue Ser291) is located within the kinase linker region. Phosphorylation of Ser297 by protein kinase C (PKC) promotes Syk interaction with downstream adaptor proteins, including 14-3-3 and prohibitin. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human spleen tyrosine kinase , transcript variant 1 with N terminal Myc tag. |
NCBI Ref Seq | NM_003177.5 |
RefSeq ORF Size | 1908 bp |
Vector | pCMV3-SP-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.