SYK cDNA ORF Clone, Human, C-His tag - CD BioSciences

service-banner

SYK cDNA ORF Clone, Human, C-His tag

SYK cDNA ORF Clone, Human, C-His tag

SPD-14351

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human spleen tyrosine kinase , transcript variant 1 with C terminal His tag.
Target Information
Species Human
Target Name SYK
Gene Abbr. SYK
Gene ID 6850
Full Name spleen associated tyrosine kinase
Alias p72-Syk
Introduction Syk is a protein tyrosine kinase that plays an important role in intracellular signal transduction in hematopoietic cells. Syk interacts with immunoreceptor tyrosine-based activation motifs (ITAMs) located in the cytoplasmic domains of immune receptors. It couples the activated immunoreceptors to downstream signaling events that mediate diverse cellular responses, including proliferation, differentiation, and phagocytosis. There is also evidence of a role for Syk in nonimmune cells and investigators have indicated that Syk is a potential tumor suppressor in human breast carcinomas. Tyr323 is a negative regulatory phosphorylation site within the SH2-kinase linker region in Syk. Phosphorylation at Tyr323 provides a direct binding site for the TKB domain of Cbl. Tyr352 of Syk is involved in the association of PLCγ1. Tyr525 and Tyr526 are located in the activation loop of the Syk kinase domain; phosphorylation at Tyr525/526 of human Syk (equivalent to Tyr519/520 of mouse Syk) is essential for Syk function.Ser297 of human Syk protein-tyrosine kinase (corresponding to mouse Syk residue Ser291) is located within the kinase linker region. Phosphorylation of Ser297 by protein kinase C (PKC) promotes Syk interaction with downstream adaptor proteins, including 14-3-3 and prohibitin.
Product Details
Description Full length Clone DNA of Human spleen tyrosine kinase , transcript variant 1 with C terminal His tag.
NCBI Ref Seq NM_003177.5
RefSeq ORF Size 1953 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Restriction Sites KpnI + XbaI (6kb + 1.95kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.