SUMO4 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

SUMO4 cDNA ORF Clone, Human, untagged

SUMO4 cDNA ORF Clone, Human, untagged

SPD-14349

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human SMT3 suppressor of mif two 3 homolog 4 (S. cerevisiae).
Target Information
Species Human
Target Name SUMO-3
Gene Abbr. SUMO4
Gene ID 387082
Full Name small ubiquitin like modifier 4
Alias IDDM5, SMT3H4, SUMO-4, dJ281H8.4
Product Details
Description Full length Clone DNA of Human SMT3 suppressor of mif two 3 homolog 4 (S. cerevisiae).
NCBI Ref Seq BC130305
RefSeq ORF Size 288 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.