Sumo3 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Sumo3 cDNA ORF Clone, Mouse, untagged

Sumo3 cDNA ORF Clone, Mouse, untagged

SPD-14339

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse SMT3 suppressor of mif two 3 homolog 3 (yeast).
Target Information
Species Mouse
Target Name SUMO-3
Gene Abbr. Sumo3
Gene ID 20610
Full Name small ubiquitin-like modifier 3
Alias 2810014B19Rik, D10Ertd345, D10Ertd345e, SMT, SMT3A
Product Details
Description Full length Clone DNA of Mouse SMT3 suppressor of mif two 3 homolog 3 (yeast).
NCBI Ref Seq NM_019929.3
RefSeq ORF Size 333 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.