Sumo2 cDNA ORF Clone, Rat, C-His tag - CD BioSciences

service-banner

Sumo2 cDNA ORF Clone, Rat, C-His tag

Sumo2 cDNA ORF Clone, Rat, C-His tag

SPD-14291

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat small ubiquitin-like modifier 2 with C terminal His tag.
Target Information
Species Rat
Target Name SUMO-2
Gene Abbr. Sumo2
Gene ID 690244
Full Name small ubiquitin-like modifier 2
Alias Smt3A, Smt3h2
Introduction Small ubiquitin-related modifier 1, 2 and 3 (SUMO-1, -2 and -3) are members of the ubiquitin-like protein family. The covalent attachment of the SUMO-1, -2 or -3 (SUMOylation) to target proteins is analogous to ubiquitination. This post-translational modification is a reversible, multi-step process that is initiated by cleaving a precursor protein to a mature protein. Mature SUMO-1, -2 or -3 is then linked to the activating enzyme E1, conjugated to E2 and in conjunction with E3, SUMO-1, -2 or -3 is ligated to the target protein. Ubiquitin and the individual SUMO family members are all targeted to different proteins with diverse biological functions. Ubiquitin predominantly regulates degradation of its target. In contrast, SUMO-1 is conjugated to RanGAP, PML, p53 and IκB-α to regulate nuclear trafficking, formation of subnuclear structures, regulation of transcriptional activity and protein stability. SUMO-2/-3 forms poly-(SUMO) chains, is conjugated to topoisomerase II and APP, regulates chromosomal segregation and cellular responses to environmental stress, and plays a role in the progression of Alzheimer disease.
Product Details
Description Full length Clone DNA of Rat small ubiquitin-like modifier 2 with C terminal His tag.
NCBI Ref Seq NM_133594.2
RefSeq ORF Size 288 bp
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.