Online Inquiry
SUMO1 Knockout Cell Line
SPL-03550
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
28bp deletion |
Target Information | |
---|---|
Target Name | SUMO-1 |
Gene Abbr. | SUMO1 |
Gene ID | 7341 |
Full Name | small ubiquitin like modifier 1 |
Alias | DAP1, GMP1, OFC10, PIC1, SENP2 |
Species | Human |
Genomic Locus | chr2:202207273 |
Transcript | NM_003352 |
WT Expression Level | 285.19 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a protein that is a member of the SUMO (small ubiquitin-like modifier) protein family. It functions in a manner similar to ubiquitin in that it is bound to target proteins as part of a post-translational modification system. However, unlike ubiquitin which targets proteins for degradation, this protein is involved in a variety of cellular processes, such as nuclear transport, transcriptional regulation, apoptosis, and protein stability. It is not active until the last four amino acids of the carboxy-terminus have been cleaved off. Several pseudogenes have been reported for this gene. Alternate transcriptional splice variants encoding different isoforms have been characterized. [provided by RefSeq, Jul 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 28bp deletion in a coding exon of SUMO1. |
Description | 28bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | AGTTTATCAGGAACAAACGG |
PCR Primer |
Forward: TGATCACCAAAAATCAGCACAATGA Reverse: AGTGTAAGTATGGGTCACATTTGGA |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.