Online Inquiry
Sumo1 cDNA ORF Clone, Mouse, N-FLAG tag
SPD-14255
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse SMT3 suppressor of mif two 3 homolog 1 (yeast) with N terminal Flag tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | SUMO-1 |
Gene Abbr. | Sumo1 |
Gene ID | 22218 |
Full Name | small ubiquitin-like modifier 1 |
Alias | GMP1, PI, PIC1, SE, SENTRIN |
Introduction | Small ubiquitin-related modifier 1, 2 and 3 (SUMO-1, -2 and -3) are members of the ubiquitin-like protein family. The covalent attachment of the SUMO-1, -2 or -3 (SUMOylation) to target proteins is analogous to ubiquitination. This post-translational modification is a reversible, multi-step process that is initiated by cleaving a precursor protein to a mature protein. Mature SUMO-1, -2 or -3 is then linked to the activating enzyme E1, conjugated to E2 and in conjunction with E3, SUMO-1, -2 or -3 is ligated to the target protein. Ubiquitin and the individual SUMO family members are all targeted to different proteins with diverse biological functions. Ubiquitin predominantly regulates degradation of its target. In contrast, SUMO-1 is conjugated to RanGAP, PML, p53 and IκB-α to regulate nuclear trafficking, formation of subnuclear structures, regulation of transcriptional activity and protein stability. SUMO-2/-3 forms poly-(SUMO) chains, is conjugated to topoisomerase II and APP, regulates chromosomal segregation and cellular responses to environmental stress, and plays a role in the progression of Alzheimer disease. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse SMT3 suppressor of mif two 3 homolog 1 (yeast) with N terminal Flag tag. |
NCBI Ref Seq | NM_009460.2 |
RefSeq ORF Size | 306 bp |
Vector | pCMV3-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.